ID: 968312255_968312259

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968312255 968312259
Species Human (GRCh38) Human (GRCh38)
Location 3:197693871-197693893 3:197693902-197693924
Sequence CCTTCCAGTGTCACAATATAAGG ATGACCTCAACAGAGAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161} {0: 1, 1: 0, 2: 2, 3: 30, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!