ID: 968315307_968315309

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 968315307 968315309
Species Human (GRCh38) Human (GRCh38)
Location 3:197719097-197719119 3:197719149-197719171
Sequence CCTGAGAATCAGTCTGACTCATG CATTCTGTACTGATCTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160} {0: 1, 1: 0, 2: 2, 3: 3, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!