ID: 968315426_968315433

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968315426 968315433
Species Human (GRCh38) Human (GRCh38)
Location 3:197720293-197720315 3:197720327-197720349
Sequence CCCTTAAGGTAACATCCTCCAGG TGCCAAAACTGAAAGAATTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147} {0: 1, 1: 0, 2: 3, 3: 22, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!