ID: 968388078_968388080

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 968388078 968388080
Species Human (GRCh38) Human (GRCh38)
Location 4:162697-162719 4:162739-162761
Sequence CCAAACTTTCTTTGACATTAGAG TTTTACAAATGTAATAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193} {0: 1, 1: 0, 2: 10, 3: 134, 4: 1200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!