ID: 968419234_968419241

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 968419234 968419241
Species Human (GRCh38) Human (GRCh38)
Location 4:468689-468711 4:468709-468731
Sequence CCTTCTTCTCTGCAACCCCAGAG GAGGTAATCTCATCAGCCTGGGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 5, 3: 66, 4: 478} {0: 2, 1: 3, 2: 5, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!