ID: 968461232_968461244

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968461232 968461244
Species Human (GRCh38) Human (GRCh38)
Location 4:726047-726069 4:726076-726098
Sequence CCAGCAGTGGGCAGCCGCGGGCG GCTGTGGGGCAGAGGCTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 187} {0: 1, 1: 1, 2: 9, 3: 77, 4: 740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!