ID: 968487252_968487268

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968487252 968487268
Species Human (GRCh38) Human (GRCh38)
Location 4:868633-868655 4:868680-868702
Sequence CCCAGCATCATACTGAGCCGTGG GCTTCCCTGCAGGAGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 70} {0: 1, 1: 0, 2: 3, 3: 42, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!