ID: 968496807_968496811

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 968496807 968496811
Species Human (GRCh38) Human (GRCh38)
Location 4:922843-922865 4:922894-922916
Sequence CCTATACGCAAGTGTCACAGCAG CAGCCCAGATGTCCTTCCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70} {0: 2, 1: 7, 2: 39, 3: 201, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!