ID: 968551600_968551604

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 968551600 968551604
Species Human (GRCh38) Human (GRCh38)
Location 4:1226296-1226318 4:1226309-1226331
Sequence CCCCATCCGGATGATTGCATTCC ATTGCATTCCTGTGTCCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 187} {0: 1, 1: 0, 2: 0, 3: 0, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!