ID: 968575887_968575900

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 968575887 968575900
Species Human (GRCh38) Human (GRCh38)
Location 4:1365972-1365994 4:1366008-1366030
Sequence CCCTAAGCCCCGGGGGCACCGCC TGTGACGCCATTCCACAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!