ID: 968624615_968624629

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 968624615 968624629
Species Human (GRCh38) Human (GRCh38)
Location 4:1621561-1621583 4:1621602-1621624
Sequence CCGCCACCCAGCCTCCACAGCGG GAATCAGGATTAGCTCCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 405} {0: 1, 1: 0, 2: 1, 3: 9, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!