ID: 968625912_968625919

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968625912 968625919
Species Human (GRCh38) Human (GRCh38)
Location 4:1626624-1626646 4:1626650-1626672
Sequence CCGGGACAGTGTAAACTCTCAGC GGCCATGCCCTGAGCCCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 150} {0: 2, 1: 1, 2: 0, 3: 30, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!