ID: 968626985_968626993

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 968626985 968626993
Species Human (GRCh38) Human (GRCh38)
Location 4:1630172-1630194 4:1630202-1630224
Sequence CCCCTTCCAAGCTGTCGGAGCTG GGCAGGTGCACAAGACAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 26, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!