ID: 968631229_968631245

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 968631229 968631245
Species Human (GRCh38) Human (GRCh38)
Location 4:1653214-1653236 4:1653266-1653288
Sequence CCCGGGTGTCCATGAGCCCTGGT CACACCTCACACTCTACCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!