ID: 968639591_968639593

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968639591 968639593
Species Human (GRCh38) Human (GRCh38)
Location 4:1706140-1706162 4:1706158-1706180
Sequence CCAGGTGCAGTGGTGCGCACCAG ACCAGTAGGCCCCAGCTACTAGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 194, 3: 1930, 4: 16366} {0: 1, 1: 0, 2: 65, 3: 274, 4: 750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!