ID: 968646573_968646587

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 968646573 968646587
Species Human (GRCh38) Human (GRCh38)
Location 4:1744129-1744151 4:1744165-1744187
Sequence CCTGCTGGCCTCCCCTGCCTGTC GCTCAGCTCCAGAGGGAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 90, 4: 568} {0: 1, 1: 0, 2: 1, 3: 36, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!