ID: 968671888_968671891

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968671888 968671891
Species Human (GRCh38) Human (GRCh38)
Location 4:1856354-1856376 4:1856385-1856407
Sequence CCGGGGCGGCTGGCTCCTGGGGC TCCTGGTTCCCGTCGTACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 408} {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!