ID: 968702093_968702100

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968702093 968702100
Species Human (GRCh38) Human (GRCh38)
Location 4:2062072-2062094 4:2062093-2062115
Sequence CCATGAGGAAGCACAGGCCACAG AGCAACACAGGGGGCTCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 52, 4: 384} {0: 1, 1: 0, 2: 0, 3: 38, 4: 1208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!