ID: 968742825_968742829

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 968742825 968742829
Species Human (GRCh38) Human (GRCh38)
Location 4:2339972-2339994 4:2339987-2340009
Sequence CCCTTGGGTCTGGGGGCTCCCTG GCTCCCTGCAGGAGGAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 342} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!