ID: 968798317_968798320

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968798317 968798320
Species Human (GRCh38) Human (GRCh38)
Location 4:2724570-2724592 4:2724588-2724610
Sequence CCAGGCACAGCGTTCACACCTTG CCTTGTAATCCCAGCTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134} {0: 3, 1: 492, 2: 18893, 3: 329837, 4: 352707}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!