ID: 968810460_968810470

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 968810460 968810470
Species Human (GRCh38) Human (GRCh38)
Location 4:2797429-2797451 4:2797481-2797503
Sequence CCTGGGCTAGGCATGCACTGCAA GACCGCTGGCAGGTGCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 94} {0: 1, 1: 0, 2: 1, 3: 2, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!