ID: 968830991_968831007

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 968830991 968831007
Species Human (GRCh38) Human (GRCh38)
Location 4:2932995-2933017 4:2933039-2933061
Sequence CCAGTGGCCATGAGGGGCCCACA AACCCCATGGGGCTACTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 225} {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!