ID: 968830992_968831007

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 968830992 968831007
Species Human (GRCh38) Human (GRCh38)
Location 4:2933002-2933024 4:2933039-2933061
Sequence CCATGAGGGGCCCACAGCCACCT AACCCCATGGGGCTACTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 733} {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!