ID: 968889999_968890015

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968889999 968890015
Species Human (GRCh38) Human (GRCh38)
Location 4:3363799-3363821 4:3363849-3363871
Sequence CCCCTGGGACCCAGGGGTCAGGG CTGAGGGTGGCCTGGAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 436} {0: 1, 1: 0, 2: 5, 3: 81, 4: 710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!