ID: 968900499_968900507

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968900499 968900507
Species Human (GRCh38) Human (GRCh38)
Location 4:3429361-3429383 4:3429411-3429433
Sequence CCAGGGCGTACTTGCCAGTCCAC GGCTGTGGAGTCTGACCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 43} {0: 1, 1: 0, 2: 5, 3: 37, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!