ID: 968904849_968904860

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968904849 968904860
Species Human (GRCh38) Human (GRCh38)
Location 4:3446408-3446430 4:3446433-3446455
Sequence CCTTCCCGGGGTCCCCGGTAACC CTCTGACCCCTCTGGGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105} {0: 1, 1: 0, 2: 6, 3: 103, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!