ID: 968908175_968908180

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968908175 968908180
Species Human (GRCh38) Human (GRCh38)
Location 4:3463963-3463985 4:3463977-3463999
Sequence CCCAGGCAGACGAGAGGCTGGGC AGGCTGGGCTGCGGTAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 243} {0: 1, 1: 0, 2: 2, 3: 69, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!