ID: 968916817_968916823

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968916817 968916823
Species Human (GRCh38) Human (GRCh38)
Location 4:3500254-3500276 4:3500272-3500294
Sequence CCCCAGGACCCGTGGCTGTGGAC TGGACAGCCCAGGACCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 180} {0: 1, 1: 0, 2: 1, 3: 30, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!