ID: 968919694_968919699

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968919694 968919699
Species Human (GRCh38) Human (GRCh38)
Location 4:3516102-3516124 4:3516124-3516146
Sequence CCGTGTTTCCTTACCCGGAACGC CCTCCAGCTCCTTGTCCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54} {0: 1, 1: 0, 2: 0, 3: 31, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!