ID: 968976425_968976431

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968976425 968976431
Species Human (GRCh38) Human (GRCh38)
Location 4:3824509-3824531 4:3824535-3824557
Sequence CCACCTCCTTCAAAGGCTTTCTC CCGGCTCCTGCCAGCCACCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!