ID: 968996363_968996369

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 968996363 968996369
Species Human (GRCh38) Human (GRCh38)
Location 4:3948154-3948176 4:3948198-3948220
Sequence CCAGGCCTGTGGTGCCGTGGGAG AGTGTGACCGAGCCTCCCGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 8, 2: 2, 3: 2, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!