ID: 969039371_969039376

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 969039371 969039376
Species Human (GRCh38) Human (GRCh38)
Location 4:4283160-4283182 4:4283174-4283196
Sequence CCCCCCAAGAAGGGGTTAACTTG GTTAACTTGCTCTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!