ID: 969164902_969164911

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 969164902 969164911
Species Human (GRCh38) Human (GRCh38)
Location 4:5299092-5299114 4:5299138-5299160
Sequence CCACCCTGCTTCTGCTTGCCCTT CCAGTTCCAGTGAGATGAACTGG
Strand - +
Off-target summary {0: 3, 1: 77, 2: 306, 3: 637, 4: 1268} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!