|
Left Crispr |
Right Crispr |
Crispr ID |
969164902 |
969164912 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:5299092-5299114
|
4:5299139-5299161
|
Sequence |
CCACCCTGCTTCTGCTTGCCCTT |
CAGTTCCAGTGAGATGAACTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 77, 2: 306, 3: 637, 4: 1268} |
{0: 5, 1: 111, 2: 619, 3: 1071, 4: 1345} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|