ID: 969174984_969174993

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 969174984 969174993
Species Human (GRCh38) Human (GRCh38)
Location 4:5391630-5391652 4:5391683-5391705
Sequence CCTGGCTGGGCCACAGGGTGCAG GCCTGAAGGCCTTTGGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 95, 4: 1845} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!