ID: 969210655_969210662

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 969210655 969210662
Species Human (GRCh38) Human (GRCh38)
Location 4:5684732-5684754 4:5684767-5684789
Sequence CCAGTGCCCTAGGATGGTGACTG GGGTCTTTACAGAGGTAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144} {0: 1, 1: 0, 2: 8, 3: 34, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!