ID: 969212473_969212477

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 969212473 969212477
Species Human (GRCh38) Human (GRCh38)
Location 4:5698326-5698348 4:5698359-5698381
Sequence CCAGGGTGGTAGATAAGACACTA GGAGAGAACTGGACTCTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 1, 4: 95} {0: 1, 1: 0, 2: 1, 3: 10, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!