ID: 969213200_969213209

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 969213200 969213209
Species Human (GRCh38) Human (GRCh38)
Location 4:5703866-5703888 4:5703911-5703933
Sequence CCATTTTAAATGGGGTTATGTTG AGTGGCTGTCAGGGTATCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 482} {0: 1, 1: 0, 2: 2, 3: 29, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!