ID: 969218462_969218466

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 969218462 969218466
Species Human (GRCh38) Human (GRCh38)
Location 4:5742987-5743009 4:5743014-5743036
Sequence CCCACTTTCAATTACATGCAAAT GGGCAGTTCATTGCAAATTGAGG
Strand - +
Off-target summary {0: 26, 1: 115, 2: 189, 3: 287, 4: 465} {0: 1, 1: 0, 2: 6, 3: 23, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!