ID: 969291653_969291668

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969291653 969291668
Species Human (GRCh38) Human (GRCh38)
Location 4:6243914-6243936 4:6243962-6243984
Sequence CCTGCCCCAGGACCAGCCTCCAG GCTCCCATAGCAGCAAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 90, 4: 741} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!