ID: 969306445_969306450

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 969306445 969306450
Species Human (GRCh38) Human (GRCh38)
Location 4:6328692-6328714 4:6328726-6328748
Sequence CCAGGCAGGTGGGGTTGAGAGAC TGGATTGTGACAAGCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 233} {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!