ID: 969318488_969318496

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 969318488 969318496
Species Human (GRCh38) Human (GRCh38)
Location 4:6396113-6396135 4:6396154-6396176
Sequence CCAGCTTCCACATGGGGAAACCA CTTGTACTCCACCCAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 714} {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!