ID: 969326005_969326014

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 969326005 969326014
Species Human (GRCh38) Human (GRCh38)
Location 4:6444244-6444266 4:6444274-6444296
Sequence CCTTTGACACCATTACAGGAGGT CGCGGAGATCAGGGAGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 98} {0: 1, 1: 0, 2: 0, 3: 22, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!