ID: 969326603_969326611

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 969326603 969326611
Species Human (GRCh38) Human (GRCh38)
Location 4:6447884-6447906 4:6447927-6447949
Sequence CCTTTCCCACAGTGAGAATCGTA AAATGTGATAGGAAGTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109} {0: 1, 1: 2, 2: 3, 3: 29, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!