ID: 969337915_969337935

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 969337915 969337935
Species Human (GRCh38) Human (GRCh38)
Location 4:6522517-6522539 4:6522559-6522581
Sequence CCTCCAGCCCCATGTTCCCCACA GCCCCCGGAGTCACCGGGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 5, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!