ID: 969398467_969398470

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 969398467 969398470
Species Human (GRCh38) Human (GRCh38)
Location 4:6938319-6938341 4:6938335-6938357
Sequence CCTTGGGTGGACATAACCTCACA CCTCACATGCTCCTCTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 70} {0: 1, 1: 0, 2: 3, 3: 15, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!