ID: 969406020_969406025

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 969406020 969406025
Species Human (GRCh38) Human (GRCh38)
Location 4:6992304-6992326 4:6992333-6992355
Sequence CCTCTAAAACTGCACACCTGTGG GTGTATTCACAGATGATATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!