ID: 969406482_969406492

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 969406482 969406492
Species Human (GRCh38) Human (GRCh38)
Location 4:6996531-6996553 4:6996574-6996596
Sequence CCAGTAAAAAAAAAAAAAAGATG GCGAAAACAGGGCTGCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 260, 3: 2715, 4: 17542} {0: 2, 1: 13, 2: 24, 3: 121, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!