ID: 969460228_969460246

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 969460228 969460246
Species Human (GRCh38) Human (GRCh38)
Location 4:7325120-7325142 4:7325169-7325191
Sequence CCAGGCCCCCTTGGGTGGGGCGG GGTGCAGGGCACTGGGGAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 53, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!