ID: 969460240_969460246

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 969460240 969460246
Species Human (GRCh38) Human (GRCh38)
Location 4:7325152-7325174 4:7325169-7325191
Sequence CCATCTGCAGATGAGGAGGTGCA GGTGCAGGGCACTGGGGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 264} {0: 1, 1: 0, 2: 5, 3: 53, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!